Effect of MEF2A and SLC22A3-LPAL2-LPA gene polymorphisms on warfarin sensitivity and responsiveness in Jordanian cardiovascular patients.

AIMS: This study aims to investigate the influence of MEF2A and SLC22A3-LPAL2-LPA polymorphisms on cardiovascular disease susceptibility and responsiveness to warfarin medication in Jordanian patients, during the initiation and maintenance phases of treatment. BACKGROUNDS: Several candidate genes have been reported to be involved in warfarin metabolism and studying such genes may help in finding an accurate way to determine the needed warfarin dose to lower the risk of adverse drug effects, resulting in more safe anticoagulant therapy. METHODS: The study population included 212 cardiovascular patients and 213 healthy controls. Genotyping of MEF2A and SLC22A3-LPAL2-LPA polymorphisms was conducted to examine their effects on warfarin efficiency and cardiovascular disease susceptibility using PCR-based methods. RESULTS: One SNP (SLC22A3-LPAL2-LPA rs10455872) has been associated with cardiovascular disease in the Jordanian population, whereas the other SNPs in the MEF2A gene and SLC22A3-LPAL2-LPA gene cluster did not have any significant differences between cardiovascular patients and healthy individuals. Moreover, SLC22A3-LPAL2-LPA rs10455872 was correlated with moderate warfarin sensitivity, the other SNPs examined in the current study have not shown any significant associations with warfarin sensitivity and responsiveness. CONCLUSION: Our data refer to a lack of correlation between the MEF2A polymorphism and the efficacy of warfarin treatment in both phases of treatment, the initiation, and maintenance phases. However, only rs10455872 SNP was associated with sensitivity to warfarin during the initiation phase. Furthermore, rs3125050 has been found to be associated with the international normalized number treatment outcomes in the maintenance phase.

The impact of IDH and NAT2 gene polymorphisms in acute myeloid leukemia risk and overall survival in an Arab population: A case-control study.

Acute myeloid leukemia (AML) is a malignancy of the myeloid cells due to the clonal and malignant proliferation of blast cells. The etiology of AML is complex and involves environmental and genetic factors. Such genetic aberrations include FLT3, DNMT3, IDH1, IDH2, NAT2, and WT. In this study, we analyzed the relationship between five, not previously studied in any Arab population, single nucleotide polymorphisms (SNPs) and the risk and overall survival of AML in Jordanian patients. The SNPs are NAT2 (rs1799930 and rs1799931), IDH1 (rs121913500), and IDH2 (rs121913502 and rs1057519736). A total number of 30 AML patients and 225 healthy controls were included in this study. Females comprised 50% (n = 15) and 65.3% (n = 147) of patients and controls, respectively. For AML patients (case group) Genomic DNA was extracted from formalin-fixed paraffin-embedded tissues and from peripheral blood samples for the control subjects group. Genotyping of the genetic polymorphisms was conducted using a sequencing protocol. Our study indicates that NAT2 rs1799930 SNP had a statistically significant difference in genotype frequency between cases and controls (p = 0.023) while IDH mutations did not correlate with the risk and survival of AML in the Jordanian population. These results were also similar in the TCGA-LAML cohorts with the notable exception of the rare NAT2 mutation. A larger cohort study is needed to further investigate our results.

Integrative analysis of gene expression and DNA methylation to identify biomarkers of non-genital warts induced by low-risk human papillomaviruses infection.

Background: Human papillomaviruses have been shown to dysregulate the gene expression and DNA methylation profiles of their host cells over the course of infection. However, there is a lack of information on the impact of low-risk HPV infection and wart formation on host cell's expression and methylation patterns. Therefore, the objective of this study is to analyse the genome and methylome of common warts using an integrative approach. Methods: In the present study, gene expression (GSE136347) and methylation (GSE213888) datasets of common warts were obtained from the GEO database. Identification of the differentially expressed and differentially methylated genes was carried out using the RnBeads R package and the edgeR Bioconductor package. Next, functional annotation of the identified genes was obtained using the Database for Annotation, Visualization, and Integrated Discovery (DAVID). Network construction and analyses of the gene-gene, protein-protein, and signaling interactions of the differentially expressed and differentially methylated genes was performed using the GeneMANIA web interface, the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database, and the Signaling Network Open Resource 2.0 (SIGNOR 2.0), respectively. Lastly, significant hub genes were identified using the Cytoscape application CytoHubba. Results: A total of 276 genes were identified as differentially expressed and differentially methylated in common warts, with 52% being upregulated and hypermethylated. Functional enrichment analysis identified extracellular components as the most enriched annotations, while network analyses identified ELN, ITGB1, TIMP1, MMP2, LGALS3, COL1A1 and ANPEP as significant hub genes. Conclusions: To the best knowledge of the authors, this is the first integrative study to be carried out on non-genital warts induced by low-risk HPV types. Future studies are required to re-validate the findings in larger populations using alternative approaches.

Genotoxicity of nedaplatin in cultured lymphocytes: modulation by vitamin E.

Nedaplatin is a chemotherapeutic agent used widely in cancer therapy. Nedaplatin has been shown to cause DNA damage to cells via the induction of oxidative stress. Vitamin E (Vit E) has an anti-mutagenic activity that can protect cells from DNA damaging agents. The objective of this study is to examine the genotoxic and cytotoxic effects of nedaplatin in human cultured lymphocytes. In addition, modulation of such effects by Vit E was also examined. The frequencies of sister chromatid exchange (SCE) and chromosomal aberrations (CAs) were used as an indicator for genotoxicity. The mitotic and proliferative indices were used to examine the cytotoxic effects of nedaplatin. The results showed that nedaplatin significantly elevated SCE and CA frequencies in human lymphocytes (p Ë‚ 0.01). The increases in the frequencies of SCE and CA caused by nedaplatin were lowered by pretreatment treatment with Vit E (p < 0.05). Nedaplatin significantly lowered mitotic index but Vit E pretreatment did not modulate this effect. These results suggest that Vit E has the potential to ameliorate the genotoxicity of nedaplatin in cultured lymphocytes.

Reduction of Genotoxicity of Carbamazepine to Human Lymphocytes by Pre-treatment with Vitamin B12.

BACKGROUND: Carbamazepine (CBZ) is widely used as an anti-epileptic drug. Vitamin B12 has been shown to protect against DNA damage caused by several mutagenic agents. OBJECTIVE: This study aimed to investigate the effect of vitamin B12 on CBZ-induced genotoxicity in cultured human lymphocytes. METHODS: Sister chromatid exchanges (SCEs) and chromosomal aberrations (CAs) genotoxic assays were utilized to achieve the study objective. RESULTS: The results showed significantly higher frequencies of CAs and SCEs in the CBZ-treated cultures (12 µg/mL) compared to the control group (P<0.01). The genotoxic effects of CBZ were reduced by pre-treatment of cultures with vitamin B12 (13.5µg/ml, P<0.05). Neither CBZ nor vitamin B-12 showed any effects on mitotic and proliferative indices. CONCLUSION: CBZ is genotoxic to lymphocyte cells, and this genotoxicity can be reduced by vitamin B12.

Network analysis of long non-coding RNA expression profiles in common warts.

Background: Long non-coding RNAs (lncRNAs) have been the subject of considerable attention in recent years due to their role in gene regulation. However, the function of lncRNAs remains poorly understood, especially in the context of infection with low-risk human papillomaviruses (HPVs). To further understanding on this issue, we investigated lncRNA expression in HPV-induced common warts. Methods: A publicly available high-throughput sequencing dataset for common warts was downloaded from the Gene Expression Omnibus (GEO). lncRNA profiles were generated using the NetworkAnalyst 3.0 workflow, and a list of differentially expressed (DE) lncRNAs in common warts was identified and inputted into the ENCODE, RegNetwork, DisGeNet, and miRNet platforms. Results: A total of 54 lncRNAs were revealed to be significantly dysregulated in common warts. Of these 54 lncRNAs, 24 and 30 were upregulated and downregulated, respectively. The most significantly differentially expressed lncRNAs in common warts included the CERNA2, LINC02159, SH3PXD2A-AS1, and UNC5B-AS1 genes. Conclusion: The current findings suggest that HPV-induced warts impact the host lncRNA transcriptome. To the best of our knowledge, the present study is the first to explore the impact of low-risk HPV infection on lncRNA expression profiles.

Genetic association of IL2RA, IL17RA, IL23R, and IL31RA single nucleotide polymorphisms with alopecia areata.

The signalling of cytokine receptors plays a crucial role in regulating tolerance and immunity. Impaired immunological processes result in autoimmune inflammation that target the hair follicles, causing many hair disorders, mainly alopecia areata (AA). Therefore, polymorphisms in cytokine receptor genes are suggested to have a significant impact on the pathogenesis of AA, a disease with a multifactorial basis and uncertain etiology. In the present study, 152 AA patients of the Jordanian population were investigated for their genetic susceptibility to develop AA compared to 150 control subjects. Genomic DNA extraction and genotyping had conducted for IL17RA (rs879575, rs2229151, and rs4819554), IL2RA (rs3118470), IL23R (rs10889677), and IL31RA (rs161704) using the Sequenom MassARRAY® system. The allele frequency of IL17RA rs879575 is significantly higher in patients, while no statistical differences were found for IL2RA, IL23R, and IL31RA SNPs. Also, the recessive model of IL31RA rs161704 showing that AA genotype is significantly associated with AA development. To date, there is no published data regarding the association between AA and the selected genetic variants in our population. However, this study's findings assert that SNPs of IL17RA and IL31RA are linked to AA susceptibility in Jordanian patients.

Pathological, molecular, and serological study of small ruminant lentiviruses in Jordan.

Background and Aim: Maedi-visna is a chronic viral disease of sheep with worldwide distribution causing substantial economic losses to the small ruminant industry. Pneumonia and mastitis are the main manifestations of the disease. This study aimed to investigate the occurrence of maedi-visna virus (MVV) in sheep using histopathology and nested polymerase chain reaction (PCR) techniques and also to estimate the seroprevalence of small ruminant lentiviruses (SRLVs) in sheep and goats using commercially available enzyme-linked immunosorbent assay (ELISA). Materials and Methods: Lung tissue samples from 380 sheep were collected and fixed in 10% formalin for histopathology and molecular diagnosis of MVV. Separately, 806 serum samples were randomly collected from 633 sheep and 173 goats to detect the seroprevalence of SRLVs using ELISA. Results: The results showed that 4.7% of lung samples (n=190) were positive by both histopathology and nested PCR, 5.8% (n = 380) were positive by histopathology only (have lymphoid follicular hyperplasia), and 7.4% (n = 190) were positive by nested PCR only. Statistical analysis revealed a moderate agreement between the two tests (Kappa=0.451, n = 190). Serology results revealed that sheep and/or goats herd prevalence was 59.8% (n = 87), while individual seroprevalence in sheep (40.1%, n = 633) was significantly higher than that in the other six countries and also significantly higher than that in goats (18.5%, n = 173) (at p < 0.05). Conclusion: The moderate statistical agreement between nested PCR and histopathological diagnosis of MVV in formalin-fixed paraffin-embedded sheep lung tissue samples (Kappa=0.451, n = 190) suggests combining both tests for more sensitive MVV detection in sheep lung samples. SRLVs seropositivity in sheep was significantly higher than in goats, thus, it is of high concern and urges the inquiry into the economic impact of the disease and the financial benefit of adopting eradication measures.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Genetic predisposition of alopecia areata in jordanians: A case-control study.

Alopecia areata (AA) is a common non-scarring hair loss disease of defined patterns with varied patches size and body sites. The etiology of AA has a complex basis of autoimmunity, environment, and genetic variations. The latter factor is found to play a crucial role in AA risk. Thus, this study aimed to investigate the potential impact of specific immune-related gene polymorphisms among a cohort of Jordanian patients, which was previously reported in other populations. Blood samples of AA patients and control subjects were collected for genomic DNA (gDNA) extraction. Targeted single nucleotide polymorphisms (SNPs) of MASP2, TLR1, CTLA4, and C11orf30 were genotyped in duplicate using the Sequenom MassARRAY® system (iPLEX GOLD). Genotype and allele analysis reveals statistical differences in TLR1 rs4833095 (allele C, P = 0.044), MASP2 rs2273346 (genotype AA, P = 0.0026), and C11orf30 rs2155219 (genotype GG, P = 0.0069) distribution. These findings present the significant contribution of genetic variations in AA susceptibility in the Jordanian population, which is infrequently studied.

The Development of a PBPK Model for Atomoxetine Using Levels in Plasma, Saliva and Brain Extracellular Fluid in Patients with Normal and Deteriorated Kidney Function.

BACKGROUND: Atomoxetine is a treatment for attention-deficit hyperactivity disorder. It inhibits Norepinephrine Transporters (NET) in the brain. Renal impairment can reduce hepatic CYP2D6 activity and atomoxetine elimination which may increase its body exposure. Atomoxetine can be secreted in saliva. OBJECTIVE: The objective of this work was to test the hypothesis that atomoxetine saliva levels (sATX) can be used to predict ATX brain Extracellular Fluid (bECF) levels and their pharmacological effects in healthy subjects and those with End-Stage Renal Disease (ESRD). METHODS: The pharmacokinetics of atomoxetine after intravenous administration to rats with chemically induced acute and chronic renal impairments were investigated. A physiologically-based pharmacokinetic (PBPK) model was built and verified in rats using previously published measured atomoxetine levels in plasma and brain tissue. The rat PBPK model was then scaled to humans and verified using published measured atomoxetine levels in plasma, saliva, and bECF. RESULTS: The rat PBPK model predicted the observed reduced atomoxetine clearance due to renal impairment in rats. The PBPK model predicted atomoxetine exposure in human plasma, sATX and bECF. Additionally, it predicted that ATX bECF levels needed to inhibit NET are achieved at 80 mg dose. In ESRD patients, the developed PBPK model predicted that the previously reported 65% increase in plasma exposure in these patients can be associated with a 63% increase in bECF. The PBPK simulations showed that there is a significant correlation between sATX and bECF in human. CONCLUSION: Saliva levels can be used to predict atomoxetine pharmacological response.

RAD51-UTR haplotype genetic polymorphisms and susceptibility to breast cancer in women from Jordanian population.

BACKGROUND: Genetic predisposition to breast cancer (BC) has been extensively explored to achieve an enhanced understanding of the biology of BC. Targeting candidate genes to screen different genetic variants such as RAD51 gene that plays a critical role in DNA repair pathways including the double-strand break repair system is an important task. AIM: To study several single nucleotide polymorphisms (SNPs) within RAD51-UTR gene and to find their relationship with BC risk and prognosis among Jordanian females. MATERIALS AND METHODS: In this case-control study, DNA sequencing technique was used to screen SNPs within the untranslated region (UTR) of RAD51 in 206 cases and 185 controls and the resulting data were statistically analyzed using different types of genetic analyses. Patients' clinical and pathological features were obtained from their medical records to perform genotype-phenotype association analysis. RESULTS: Our findings show a significant association between both SNPs rs528590644, rs1801320 and BC risk (p = 0.016). We estimated the correlation between many of BC prognostic factors and BC risk, and we found an association between rs1801321 and age at first menstruation (p = 0.032) in addition to a strong correlation between age at BC diagnosis and rs1801320 (p = 0.008). CONCLUSION: RAD51-UTR polymorphisms may be involved in BC development and progression.

Whole-genome sequencing and phylogenetic analysis of rabies viruses from Jordan.

Human fatalities caused by rabies are rarely reported in Jordan; however, domestic animals are more likely to fall victim to rabies compared to wild animals, at least this is the case in Jordan due to the presence of canine rabies. In this study, twelve brain samples from domestic and wild animals suspected of being infected with rabies virus from different regions of Jordan were collected during 2019. Seven of them tested positive using the fluorescent antibody test and real-time SYBR RT-PCR assay. Five specimens were from stray dogs and two from foxes. The whole genome sequences were obtained from the positive samples. Sequence analysis showed that one dog virus from Al Quwaysimah city located in Amman governorate, was closely related to an Israeli strain belonging to a Cosmopolitan ME1a clade. The genomes of the remaining six viruses (four from dogs and two from foxes) collected from different areas of Jordan were genetically-related to each other and clustered together with sequences from Iran and Turkey; all belong to Cosmopolitan ME2 clade. These sequences were analyzed with six other Jordanian rabies virus nucleoprotein (N) gene sequences available in the public database, five of them belong to ME1a clade and one belongs to ME1b clade. Rabies virus whole genome data is scarce across the Middle East. This study provides a better understanding of the molecular epidemiology of rabies virus in the region.

Improving public stigma, sociocultural beliefs, and social identity for people with epilepsy in the Aseer region of Saudi Arabia.

Differences in the sociocultural practice and biases against people with epilepsy (PWE) largely contribute to the development of stigmatization. In this study, we evaluated factors that impact stigma for PWE involved in evolution and maintenance to report changes in the public awareness and cultural practices. We performed a cross-sectional study in which data were collected from a self-administered electronic survey composed of 33 items targeting the population in the Aseer region. Feedback response was obtained from 937 respondents. Of these, 921 participants (98.3%) had heard or read about the disorder previously. Approximately 84.8% believed that epilepsy was one of the brain disorders. 95.8% disagreed that epilepsy was due to a contagious disease. However, 40.1% of the responders were convinced that it was the result of a spiritual reason. Still, more than 9% believed treating PWE should be approached spiritually. About 75% felt that epilepsy could be the results of a test delievered by God. In addition to the clinical impact from seizures in PWE, it carries a social label and public stigma that influences one's social prognosis. Raising awareness through campaigns would improve the knowledge and practices of the population and hence provide a healthier environment for PWE, alleviating feelings of stigma, and improving their quality of life.

Association of DRD4 exon III and 5-HTTLPR VNTR genetic polymorphisms with psychiatric symptoms in hemodialysis patients.

Mental illness is prevalent among hemodialysis (HD) patients. Given that the dopaminergic and serotonergic pathways are involved in the etiology of psychiatric disease, this study evaluated the genetic association of dopamine D4 receptor (DRD4) and serotonin transporter (SLC6A4) genes with psychiatric symptom susceptibility among HD patients. Hospital Anxiety and Depression Scale (HADS) was used to assess anxiety and depressive symptoms among patients (n = 265). Genetic polymorphisms of DRD4 (48 bp VNTR) and SLC6A4 (5-HTTLPR VNTR and rs25531) were examined using a conventional polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique, as appropriate. Significant differences were observed in the distribution of 5-HTTLPR genotypes, SLC6A4 tri-allelic-phased genotype, and DRD4-Exon III VNTR genotypes/alleles between patients with anxiety symptoms versus those with normal/borderline conditions (p<0.05). Binary logistic regression analyses showed that the heterozygous 4,5 VNTR genotype of DRD4 was associated with a higher risk of anxiety symptoms after adjusting for other covariates (odds ratio = 4.25, p = 0.028). None of the studied polymorphisms was linked to depression in HD patients. Collectively, the current findings provide genetic clues to psychopathology in HD patients and suggest that the DRD4 exon III VNTR polymorphism is involved in the etiology of anxiety in this patient population.

Influence of CYP4F2, ApoE, and CYP2A6 gene polymorphisms on the variability of Warfarin dosage requirements and susceptibility to cardiovascular disease in Jordan.

Cardiovascular diseases are among the leading causes of death worldwide. Many of those diseases require treatment with warfarin, an anticoagulant that has a large high inter and intra-variability in the required doses. The aim of this study is to find if there are any associations between rs2108622 of CYP4F2, rs7412 and rs405509 of ApoE, and rs1801272 of CYP2A6, and CVD and warfarin dose variability. The selected genes and their polymorphisms are involved in many GWAS associated with cardiovascular disease and variability in warfarin treatment. The study sample consisted of 212 Jordanian Cardiovascular patients and 213 healthy controls. DNA was extracted and the Mass ARRAY™ system was used to genotype four selected SNPs within three genes (CYP4F2, ApoE, and CYP2A6). Only one out of the four selected SNPs (ApoE rs7412 SNP) was found to be associated with the risk of cardiovascular disease. Also, this SNP showed significant differences in warfarin initial doses. CYP2A6 rs1801272 SNP was found to be associated with warfarin sensitivity during the initiation phase of therapy and with warfarin responsiveness and INR measurement during the stabilization phase of therapy. This study improves the current understanding of the high inter and intra-variabilities in response to warfarin, including the variety of dosing requirements and the susceptibility to cardiovascular disease in the Jordanian Arab population. Further study on a larger sample and in different ethnic groups could help in improving our understanding of warfarin's pharmacogenetics and its application in personalized medicine.

Global gene methylation profiling of common warts caused by human papillomaviruses infection.

Infection with the human papillomaviruses (HPV) often involves the epigenetic modification of the host genome. Despite its prevalence among the population, host genome methylation in HPV-induced warts is not clearly understood. In this study, genome-wide methylation profiling was carried out on paired healthy skin and wart samples in order to investigate the effects that benign HPV infection has on gene methylation status. To overcome this gap in knowledge, paired wart (n = 12) and normal skin (n = 12) samples were obtained from Arab males in order to perform DNA extraction and subsequent genome-wide methylation profiling on the Infinium Methylation EPIC Bead Chip microarray. Analysis of differential methylation revealed a clear pattern of discrimination between the wart and normal skin samples. In warts, the most differentially methylated (DM) genes included long non-coding RNAs (AC005884, AL049646.2, AC126121.2, AP001790.1, and AC107959.3), microRNAs (MIR374B, MIR596, MIR1255B1, MIR26B, and MIR196A2),snoRNAs (SNORD114-22, SNORD70, and SNORD114-31), pseudogenes (AC069366.1, RNU4ATAC11P, AC120057.1, NANOGP3, AC106038.2, TPT1P2, SDC4P, PKMP3, and VN2R3P), and protein-coding genes (AREG, GJB2, C12orf71, AC020909.2, S100A8, ZBED2, FABP7, and CYSLTR1). In addition, pathway analysis revealed that, among the most differentially methylated genes, STAT5A, RARA, MEF2D, MAP3K8, and THRA were the common regulators. It can be observed that HPV-induced warts involve a clear and unique epigenetic alteration to the host genome.

Association of CYP2C19, TNF-α, NOD1, NOD2, and PPARγ polymorphisms with peptic ulcer disease enhanced by Helicobacter pylori infection.

OBJECTIVES: To assess the correlation between a number of genetic variations of CYP2C19, TNF-α, NOD1, NOD2, and PPARγ genes with the severity of Helicobacter pylori (H. pylori) infections and peptic ulcers (PU). METHODS: A retrospective cross-sectional design was used in this study. Formalin-fixed paraffin-embedded (FFPE) tissue was used to extract genomic DNA that was collected from Jordanian patients who visited endoscopy clinics between 2014 to 2018 at the King Abdullah University Hospital (KAUH), Irbid, Jordan. Genotyping of the studied single nucleotide polymorphisms (SNPs) were applied using the sequencing protocol. Results:  A total of 251 patients (mean age: 42.12 ± 16.09 years) and healthy controls (mean age: 52.76 ± 19.45 years) were enrolled in this study. This study showed no significant association between patients and the studied polymorphisms except for rs2075820 of the NOD1 (p=0.0046). It is hypothesized that the heterozygous genotype (TC); 44.8% in patients versus 61.3% in controls has a decreased risk of peptic ulcers (OR:  0.49). The alleles frequency association was insignificant in all studied SNPs with a p-value more than 0.05. CONCLUSION: This study provided evidence regarding the association of the rs2075820 with H. pylori infections. The other studied SNPs were not statistically significant.

Genetic susceptibility of opioid receptor genes polymorphism to drug addiction: A candidate-gene association study.

BACKGROUND: Like other complex diseases including drug addiction, genetic factors can interfere with the disease. In this study, three opioid genes (OPRM1, OPRD1, and OPRK1) were examined for an association with drug addiction among Jordanian males. METHODS: The study involved 498 addicts, in addition to 496 healthy controls and all from Arab descent. RESULTS: The findings in this study showed that rs1799971 of the OPRM1 gene was in association with drug addiction for both alleles and genotypes with P-values = 0.002 and 0.01, respectively. In addition, a significant association between the dominant model (A/A vs G/A-G/G) of rs1799971 (OPRM1) and drug addiction (P-value = 0.003, OR = 1.59 (1.17-2.15)) was detected. Moreover, a genetic haplotype (AGGGCGACCCC) of theOPRM1 gene revealed a significant association with drug addiction (P-value = 0.01, OR = 1.56 (1.15-2.12)). We also found that the age of addicts, smoking, and marital status with genetic variants within OPRM1, OPRD1, and OPRK1 genes may be implicated in drug addiction risk. CONCLUSION: We propose that rs1799971 of the OPRM1gene is a genetic risk factor for drug addiction among Jordanian males.

Impact of PCSK9, WDR12, CDKN2A, and CXCL12 Polymorphisms in Jordanian Cardiovascular Patients on Warfarin Responsiveness and Sensitivity.

BACKGROUND: The main objective of this study is sought to determine the impacts of PCSK9, WDR12, CDKN2A, and CXCL12 polymorphisms on warfarin sensitivity and responsiveness in Jordanian cardiovascular patients during the initiation and stabilization phases of therapy. METHODS: This study took place at the anticoagulation clinic at Queen Alia Heart Institute (QAHI) in Jordan. DNA samples were collected from 212 cardiovascular patients and 213 healthy controls. Genomic SNPs genotyping was conducted using the MassARRAY System at the Australian Genome Research Facility. RESULTS: This study assessed 10 polymorphisms (rs11206510 within the PCSK9 gene, rs6725887 and rs7582720 within the WDR12 gene, rs4977574, rs10757278, and rs1333049 within the CDKN2A gene, rs2862116, rs7906426, rs1746048, and rs268322 within the CXCL12 gene) in 212 Jordanian cardiovascular patients. Carriers of CDKN2A rs1333049, rs10757278, and PCSK9 rs11206510 polymorphisms had an increased risk of resistance during the initiation phase of warfarin therapy compared to those who do not carry it, or those who are carrying one polymorphism only (P < 0.05), while carriers of CXCL12 rs7906426 polymorphism had similar increased risk but during the stabilization phase of warfarin therapy (P < 0.05). CONCLUSION: Carriers of CXCL12 rs2862116 polymorphism had an increased risk to be warfarin extensive responders compared to those with no or only one polymorphism (P = 0.01). However, the presence of PCSK9 rs11206510 polymorphism affects the warfarin maintenance doses (P ˃ 0.0001).